Cercam^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cercam^em1(IMPC)J
• Name: cerebral endothelial cell adhesion molecule; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788503
• Synonyms: Cercam^em1J
• Gene: Cercam Location: Chr2:29759176-29772852 bp, + strand Genetic Position: Chr2, 20.76 cM, cytoband B
• Alliance: Cercam^em1(IMPC)J page
• IMPC: Cercam gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cercam-7869J-F7768 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTCCCCCTCAGTGAACTC, AGGGAATCCTGTCTCAGACT, CTAGGCAGTAAATTTAGGAA and ACTAGCCCTTCTCCTCCACT, which resulted in a 674 bp deletion beginning at Chromosome 2 positive strand position 29,872,506 bp, TGAACTCTGGTCCCGAGTCT, and ending after CCTAAATTTACTGCCTAGTG at 29,873,179 bp (GRCm38/mm10). This mutation deletes exons 4 and 5 and 334 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is a 13 bp insertion (agggaatttctca) at the site of the deletion that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 139 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cercam Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)