Kif15^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kif15^em1(IMPC)J
• Name: kinesin family member 15; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788421
• Synonyms: Kif15^em1J
• Gene: Kif15 Location: Chr9:122780146-122847798 bp, + strand Genetic Position: Chr9, 73.31 cM, cytoband F4
• Alliance: Kif15^em1(IMPC)J page
• IMPC: Kif15 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Kif15-7892J-M7412 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAGTAGGTCTAGTATT, AGTAACAGGTAAGTTTCCTG, CATTTGAAATATGTAATGTA and CAATTTGTCACTTTTTAGCT, which resulted in a 261 bp deletion beginning at Chromosome 9 positive strand position 122,959,773 bp, GAAACTTACCTGTTACTTTT, and ending after CTTTCATTTGAAATATGTAA at 122,960,033 bp (GRCm38/mm10). This mutation deletes exon 3 and 77 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kif15 Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)