About   Help   FAQ
Zfp612em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp612em1(IMPC)J
Name: zinc finger protein 612; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5787575
Synonyms: Zfp612em1J
Gene: Zfp612  Location: Chr8:110806378-110819373 bp, + strand  Genetic Position: Chr8, 57.41 cM
Alliance: Zfp612em1(IMPC)J page
IMPC: Zfp612 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Zfp612-7727J-M3059 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCTCAGGCCCTAAGTAAAG, GAGCACAAAGTTAGTAACAA, GCGCCTTTCTTCCTAAGAAG and GTTTGGTAATTCTTTATGAG, which resulted in a 365 bp deletion around exon 3 beginning at Chromosome 8 positive strand position 110,083,490 bp, ATCCCATAGTTTACTTCCCC, and ending after CTTTCTTCCTAAGAAGTGGT at 110,083,854 bp (GRCm38/mm10). This mutation deletes exon 3 and 238 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 62 bp insertion at the same site, which was inserted from 824 bp upstream of the deletion, as well as a 20 bp deletion (tttggtaattctttatgagt) and 2 bp insertion (AG) 9 bp after the 365 bp deletion that will not alter the result of the exon deletion. This 365 bp deletion is predicted to cause a change of amino acid sequence after residue 8 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp612 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory