About   Help   FAQ
Drc7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Drc7em1(IMPC)J
Name: dynein regulatory complex subunit 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784926
Synonyms: Drc7em1J
Gene: Drc7  Location: Chr8:95781731-95804769 bp, + strand  Genetic Position: Chr8, 47.12 cM
Alliance: Drc7em1(IMPC)J page
IMPC: Drc7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Drc7-7877J-F7837 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGACTTCTTGCTCTTCCG, GCAAGTCTGGGTCTGGGGTA, GCTCAGCAGAGGAGCCGTAG and GCTCTGAGTACAGAGCTGGC, which resulted in a 292 bp deletion around exon 9 beginning at Chromosome 8 positive strand position 95,070,286 bp, CTCTTCCGGGGAAACTGACA, and ending after TCAACACCCTGCCAGCTCTG at 95,070,577 bp (GRCm38/mm10). This mutation deletes exon 9 and 219 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 404 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Drc7 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory