About   Help   FAQ
Ssx2ipem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ssx2ipem1(IMPC)J
Name: SSX family member 2 interacting protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5779850
Synonyms: Ssx2ipem1J
Gene: Ssx2ip  Location: Chr3:146110397-146145899 bp, + strand  Genetic Position: Chr3, 71.03 cM
Alliance: Ssx2ipem1(IMPC)J page
IMPC: Ssx2ip gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ssx2ip-7709J-F9191 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACACGTCTATGACAAAA, AGAATCTTTGGTAATGGAGA, TTATGTACCACAAAATGTCG and CATGCAGAGCCACCGAGCCT, which resulted in a 368 bp deletion in exon 4 beginning at Chromosome 3 positive strand position 146,418,140 bp, ATGAACTTGTGCCATTTTGT, and ending after CCACAAAATGTCGAGGCCAC at 146,418,507 bp (GRCm38/mm10). This mutation deletes exon 3 and 198 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ssx2ip Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory