About   Help   FAQ
Irgm2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Irgm2em1(IMPC)J
Name: immunity-related GTPase family M member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775779
Synonyms: Irgm2em1J
Gene: Irgm2  Location: Chr11:58105803-58113609 bp, + strand  Genetic Position: Chr11, 36.07 cM
Alliance: Irgm2em1(IMPC)J page
IMPC: Irgm2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Irgm2-7677J-F9554 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACAGGTTGGTTTCTGGG, TTCGTGTCCGATGAGCCTAA, CTTGGTAAAGGGTTTCGACG and CTCCCTGTCATCAAGTACCA, which resulted in a 442 bp deletion in exon 2 beginning at Chromosome 11 positive strand position 58,219,790 bp, CACCCAGAAACCAACCTGTT, and ending after TCAAGTACCACGGCCTCGTC at 58,220,231 bp (GRCm38/mm10). This mutation also has a 3 bp deletion (ggc) 49 bp before the 442 bp deletion. Together these are predicted to cause a change of amino acid sequence from RLI to II beginning at residue 83, due to the 3 bp deletion, followed by a change of amino acid sequence 15 residues later at amino acid 101 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Irgm2 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory