Paf1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Paf1em1(IMPC)J |
Name: |
Paf1, RNA polymerase II complex component; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5775649 |
Synonyms: |
Paf1em1J |
Gene: |
Paf1 Location: Chr7:28092376-28098813 bp, + strand Genetic Position: Chr7, 16.73 cM
|
Alliance: |
Paf1em1(IMPC)J page
|
IMPC: |
Paf1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from project Paf1-7694J-M6789 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAATGCAAGCGTCCAGCAT, TCCTAGAAGCTAAGCTTCTA, GGCCAGCAAAGGCCAGGCCT and CCATGAGGGATACCCAGGCC, which resulted in a 290 bp deletion and 6 bp insertion (ttgcaa) spanning exon 4 beginning at Chromosome 7 positive strand position 28,395,305 bp, CTGGACGCTTGCATTCAGAG, and ending after AGCAAAGGCCAGGCCTGGGT at 28,395,594 bp (GRCm38/mm10). This mutation deletes exon 4 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|