Trav1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trav1^em1(IMPC)J
• Name: T cell receptor alpha variable 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775635
• Synonyms: Trav1^em1J
• Gene: Trav1 Location: Chr14:52665424-52666333 bp, + strand Genetic Position: Chr14, 26.94 cM
• Alliance: Trav1^em1(IMPC)J page
• IMPC: Trav1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Trav1-7381J-M0733 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTTTAAACAATTCAACG, ATTTTTAAACAATTCAACGT, GCTGCACAGAAATTCTAAGA and AGCTGCACAGAAATTCTAAG, which resulted in a 434 bp deletion spanning exon 2 beginning at Chromosome 14 positive strand position 52,428,493 bp, ATTTTTTAAAATTAATTTTT, and ending after ACAGAAATTCTAAGAGGGAC at 52,428,926 bp (GRCm38/mm10). This mutation deletes exon 2 and 151 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 10 amino acids later, by run on into intron 2. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trav1 Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)