Rasal1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rasal1^em1(IMPC)J
• Name: RAS protein activator like 1 (GAP1 like); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5774569
• Synonyms: Rasal1^em1J
• Gene: Rasal1 Location: Chr5:120786877-120817662 bp, + strand Genetic Position: Chr5, 60.63 cM
• Alliance: Rasal1^em1(IMPC)J page
• IMPC: Rasal1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rasal1-7697J-M1093 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTAGAGTCTCATATGGT, TGGGGGCATGTGTAGACTCT, GAGAATGGGCTGATTCACAG and TGAACCGAATCACATATCAA, which resulted in a 481 bp deletion spanning exons 4-5 beginning at Chromosome 5 positive strand position 120,654,693 bp, TCTAGGAGTGTGTGTGTGAC, and ending after GAGGGAGAATGGGCTGATTC at 120,655,173 bp (GRCm38/mm10). This mutation deletes exons 4 and 5 and 305 bp of flanking intronic sequence including the splice acceptors and donors. This deletion of exons 4 and 5 is predicted to cause a change of amino acid sequence after residue 41 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rasal1 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)