About   Help   FAQ
Lmcd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lmcd1em1(IMPC)J
Name: LIM and cysteine-rich domains 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5771567
Synonyms: Lmcd1em1J
Gene: Lmcd1  Location: Chr6:112250747-112307384 bp, + strand  Genetic Position: Chr6, 52.14 cM
Alliance: Lmcd1em1(IMPC)J page
IMPC: Lmcd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Lmcd1-7683J-M3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATGCCAAGTCTCCCAG, GCTGCCACTCACTGTTTACT, GACGGTGTAGGATGCATGCT and GAGAGAACCACCCACAGTTT, which resulted in a 276 bp deletion spanning exon 2 beginning at Chromosome 6 positive strand position 112,304,920 bp, CAGTAAACAGTGAGTGGCAG, and ending after CTTGACTGTCCTTTCCAAAA at 112,305,195 bp (GRCm38/mm10). This mutation deletes exon 2 and 187 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a small 12 bp deletion 33 bp after the 276 bp deletion which will not affect the mutation. The 276 bp deletion is predicted to cause a change of amino acid sequence after residue 14 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lmcd1 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory