About   Help   FAQ
Plcz1em1Jparr
Endonuclease-mediated Allele Detail
Summary
Symbol: Plcz1em1Jparr
Name: phospholipase C, zeta 1; endonuclease-mediated mutation 1, John Parrington
MGI ID: MGI:5766302
Gene: Plcz1  Location: Chr6:139935399-139987183 bp, - strand  Genetic Position: Chr6, 69.77 cM, cytoband G1
Alliance: Plcz1em1Jparr page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing two sgRNAs and CRISPR/Cas9 technology (with D10A mutatnt of Cas9), 22 nucleotides (GTCAAAGGTTCAGGATGATTTT in NM_054066) were deleted from exon 3. Immunoblots with sperm derived protein confirmed the lack of full-length peptided expressed from this allele. Any potential C-terminally truncated peptide expressed from this allele would lack all functional domains. (J:243414)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Plcz1 Mutation:  55 strains or lines available
References
Original:  J:243414 Hachem A, et al., PLCzeta is the physiological trigger of the Ca2+ oscillations that induce embryogenesis in mammals but conception can occur in its absence. Development. 2017 Aug 15;144(16):2914-2924
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory