Col16a1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Col16a1em1(IMPC)J |
Name: |
collagen, type XVI, alpha 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763667 |
Synonyms: |
Col16a1em1J |
Gene: |
Col16a1 Location: Chr4:129941638-129993070 bp, + strand Genetic Position: Chr4, 63.43 cM
|
Alliance: |
Col16a1em1(IMPC)J page
|
IMPC: |
Col16a1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Col16a1-7606J-F4542 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGCATTAGGAACTCAGGA, AGAATTCCCGGAGCTCTGCT, AGGTCACTATGAACTCTGGG and TCTACCTATTGTCCACCACT, which resulted in a 437 bp deletion spanning exons 3 and 4 beginning at Chromosome 4 positive strand position 130051616 bp, CTCCTGAGTTCCTAATGCTC, and ending after ACTCTACCTATTGTCCACCA, at 130052052 bp (GRCm38/mm10). This mutation deletes exons 3 and 4 and 244 bp of flanking intronic and intron 3-4 sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 15 amino acids later. In addition, there is a 5 bp (ctctg) deletion 13 bp before the 437 bp deletion that is not predicted to impact the outcome of this mutation.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|