Adamts16em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Adamts16em1(IMPC)J |
Name: |
ADAM metallopeptidase with thrombospondin type 1 motif 16; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763624 |
Synonyms: |
Adamts16em1J |
Gene: |
Adamts16 Location: Chr13:70875921-70989930 bp, - strand Genetic Position: Chr13, 35.97 cM
|
Alliance: |
Adamts16em1(IMPC)J page
|
IMPC: |
Adamts16 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Adamts16-7577J-M3910 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGACTTGCAGACCAGCATAG, TTGCTGGCTGCTTACCTGTG, CAGTGCCCGCATTTTCACTG and ACTCTGCTGGTCCTAGCGCC, which resulted in a 271 bp deletion spanning exon 2 beginning at Chromosome 13 negative strand position 70,841,480 bp, GGCGCTAGGACCAGCAGAGT, and ending after AAGCAGCCAGCAACCCCCTA at 70,841,210 bp (GRCm38/mm10). This mutation deletes exon 2 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 9 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|