About   Help   FAQ
Adamts16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adamts16em1(IMPC)J
Name: ADAM metallopeptidase with thrombospondin type 1 motif 16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763624
Synonyms: Adamts16em1J
Gene: Adamts16  Location: Chr13:70875921-70989930 bp, - strand  Genetic Position: Chr13, 35.97 cM
Alliance: Adamts16em1(IMPC)J page
IMPC: Adamts16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Adamts16-7577J-M3910 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGACTTGCAGACCAGCATAG, TTGCTGGCTGCTTACCTGTG, CAGTGCCCGCATTTTCACTG and ACTCTGCTGGTCCTAGCGCC, which resulted in a 271 bp deletion spanning exon 2 beginning at Chromosome 13 negative strand position 70,841,480 bp, GGCGCTAGGACCAGCAGAGT, and ending after AAGCAGCCAGCAACCCCCTA at 70,841,210 bp (GRCm38/mm10). This mutation deletes exon 2 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adamts16 Mutation:  79 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory