Bzw1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bzw1^em1(IMPC)J
• Name: basic leucine zipper and W2 domains 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763137
• Synonyms: Bzw1^em1J
• Gene: Bzw1 Location: Chr1:58432057-58446512 bp, + strand Genetic Position: Chr1, 29.09 cM, cytoband C2
• Alliance: Bzw1^em1(IMPC)J page
• IMPC: Bzw1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Bzw1-7578J-M3933 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGTGGCTCAAAACTAGCG, ACGCACTGCTTTCTGCCGCC, GTGTGGGTCTTGGTGAAATA and ATATCACCCATATCGCTATA, which resulted in a 308 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 58,398,906 bp, GCGCGGTAGCCCTGGCGGCA, and ending after AAGGGTGTGGGTCTTGGTGAA at 58,399,213 bp (GRCm38/mm10). This mutation deletes exon 4 and 213 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change of amino acid sequence after residue 112 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Bzw1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)