Tgfbr3l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tgfbr3l^em1(IMPC)J
• Name: transforming growth factor, beta receptor III-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763011
• Synonyms: Tgfbr3l^em1J
• Gene: Tgfbr3l Location: Chr8:4298214-4301423 bp, + strand Genetic Position: Chr8, 1.99 cM
• Alliance: Tgfbr3l^em1(IMPC)J page
• IMPC: Tgfbr3l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tgfbr3l-7560J-F9665 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGGCATGCGGCTGAGCAT, TAGGCCCTGATGCCACTAAG, GGCGCCTTAAACGACGAGGG and GCAGGATCAAGGCGCCATCA, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 4,249,063 bp, AAGCGGTACATGGTTGTAAC, and ending after GGGGACTGGTCGACCTTGAT, at 4,249,407 bp (GRCm38/mm10). This mutation deletes exon 2 and 208 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 23 and a early truncation after an additional 55 amino acids. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tgfbr3l Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)