Acot2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Acot2em1(IMPC)J |
Name: |
acyl-CoA thioesterase 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763009 |
Synonyms: |
Acot2em1J |
Gene: |
Acot2 Location: Chr12:84034635-84040647 bp, + strand Genetic Position: Chr12, 38.99 cM, cytoband D3
|
Alliance: |
Acot2em1(IMPC)J page
|
IMPC: |
Acot2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Acot2-7575J-M3846 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGGTGCTTGAAGACCGGA, GGAAACTGTGGACTCAGCCC, CGTTGATGAGGAGATCTGAT, TATAGACTGTCTCCCAGACA, which resulted in a 378 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 83,990,413 bp, CTTTATGATCAGTCTGAAAC, and ending after TTGTGGCAGCCCCTCCCTGT at 83,990,790 bp (GRCm38/mm10). This mutation deletes exon 2 and 175 bp of flanking intronic sequence including the splice acceptor and donor. There is also a 4 bp deletion in the 5-prime intron 16 bp before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 193 and early truncation 15 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|