Rab12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab12^em1(IMPC)J
• Name: RAB12, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755652
• Synonyms: Rab12^em1J
• Gene: Rab12 Location: Chr17:66801507-66826712 bp, - strand Genetic Position: Chr17, 37.88 cM
• Alliance: Rab12^em1(IMPC)J page
• IMPC: Rab12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab12-7420J-M4534 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGCGCATCTCACTGTTAAA, TTTAACAGTGAGATGCGCAC, CGAGGTGCAGAAGTGCATAA, and CCAATCTTGTGCCCCCACCG, which resulted in a 264 bp deletion spanning exon 3 beginning at Chromosome 17 negative strand position 66,500,258 bp, TAAGGGTTTGCACTAGAAGA and ending after CCTGTGCGCATCTCACTGTT at 66,500,258 bp (GRCm38/mm10). This mutation deletes exon 3 and 125 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 94 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab12 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)