2700054A10Rik^em2(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: 2700054A10Rik^em2(IMPC)Mbp
• Name: RIKEN cDNA 2700054A10 gene; endonuclease-mediated mutation 2, Mouse Biology Program, UC Davis
• MGI ID: MGI:5755102
• Gene: 2700054A10Rik Location: Chr17:13707283-13774356 bp, - strand Genetic Position: Chr17, 8.9 cM
• Alliance: 2700054A10Rik^em2(IMPC)Mbp page
• IMPC: 2700054A10Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences TCAGAAAGGAGTCTTAACTGAGG, GTGTGTGTGTATTTCCACAAAGG, ACACAGGAGGGCTAACATGAAGG, CCTGTGGTCTTGGGTCACCAGGG, which resulted in a Inter-exdel deletion. (J:157064)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any 2700054A10Rik Mutation: 1 strain or line available

References

• Original: J:157064 University of California, Davis, Alleles produced for the KOMP project by the University of California, Davis. MGI Direct Data Submission. 2010
• All: 3 reference(s)