Meak7^em3(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Meak7^em3(IMPC)Tcp
• Name: MTOR associated protein, eak-7 homolog; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:5755090
• Gene: Meak7 Location: Chr8:120486815-120505155 bp, - strand Genetic Position: Chr8, 68.32 cM, cytoband E1
• Alliance: Meak7^em3(IMPC)Tcp page
• IMPC: Meak7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0321, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGCCAGTTGGAGCTATGCGA and GAGAAGCACGCGTCCTCCTC. This resulted in a 486 bp deletion from Chr8:119771064 to 119771549 encompassing ENSMUSE00000318051 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Meak7 Mutation: 24 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)