Spx^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spx^em1(IMPC)Tcp
• Name: spexin hormone; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755088
• Gene: Spx Location: Chr6:142359167-142365456 bp, + strand Genetic Position: Chr6, 74.03 cM
• Alliance: Spx^em1(IMPC)Tcp page
• IMPC: Spx gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0399 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences CAGCCTCATCGGACGGAGTG, TTGGTCGATGTGTCTTGTAG, ACTCCTTATTCTCCTCACGG, and GCCGGCTCCAGTAAATAATT. This resulted in a 289 bp deletion from Chr6:142413819 to 142414107 & 31 bp deletion from Chr6:142414151 to 142414181, encompassing ENSMUSE00000608439 & ENSMUSE00000608438. This mutation is predicted to cause a frameshift with amino acid changes after residue 3 and early truncation 27 amino acids later (p.G3Rfs*29). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spx Mutation: 15 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)