About   Help   FAQ
Ralyem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ralyem2(IMPC)Tcp
Name: hnRNP-associated with lethal yellow; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:5755074
Gene: Raly  Location: Chr2:154633016-154709181 bp, + strand  Genetic Position: Chr2, 76.83 cM
Alliance: Ralyem2(IMPC)Tcp page
IMPC: Raly gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0318, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATCTATACTCAAATATAGTC, ATGTAAATGACTTTATTACC, CCTCCTAGTTCTTGTAGAGT, and GCAGTCAAAGTGTGAGACTT. This resulted in a 850-bp deletion from Chr2:154859330 to 154860179 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Raly Mutation:  56 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory