About   Help   FAQ
Polr3aem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr3aem1(IMPC)Tcp
Name: polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5755028
Gene: Polr3a  Location: Chr14:24498764-24537126 bp, - strand  Genetic Position: Chr14, 14.4 cM
Alliance: Polr3aem1(IMPC)Tcp page
IMPC: Polr3a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele produced from project TCPR0244 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence AGAAGATCTCAGATAAATGC and an oligonucleotide repair template encoding a 1-bp insertion. Homology-directed repair resulted in a 1 bp insertion at Chr14:24482833 in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). A silent change at p.R151 (CGG>CGC) was also introduced which disrupts the PAM sequence. (GRCm38). (J:165963)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Polr3a Mutation:  70 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory