Polr3aem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Polr3aem1(IMPC)Tcp |
| Name: |
polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:5755028 |
| Gene: |
Polr3a Location: Chr14:24498764-24537126 bp, - strand Genetic Position: Chr14, 14.4 cM
|
| Alliance: |
Polr3aem1(IMPC)Tcp page
|
| IMPC: |
Polr3a gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Not Specified
|
| |
|
Mutation details: This allele produced from project TCPR0244 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence AGAAGATCTCAGATAAATGC and an oligonucleotide repair template encoding a 1-bp insertion. Homology-directed repair resulted in a 1 bp insertion at Chr14:24482833 in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). A silent change at p.R151 (CGG>CGC) was also introduced which disrupts the PAM sequence. (GRCm38).
(J:165963)
|
|
|
|
|
| Original: |
J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010; |
| All: |
2 reference(s) |
|