Pebp1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pebp1^em1(IMPC)Tcp
• Name: phosphatidylethanolamine binding protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755025
• Gene: Pebp1 Location: Chr5:117420716-117425629 bp, - strand Genetic Position: Chr5, 56.88 cM
• Alliance: Pebp1^em1(IMPC)Tcp page
• IMPC: Pebp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0388 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TTTTAGTAGCGGCCATACTT, GAATTACCACTAATCTGCAT, GGCTATCTATCATCCGGACA, and ATTCTGCCGTCCTTACAGTA. This resulted in a 811-bp deletion from Chr5:117285622 to 117286432 insCA (GRCm38), exons ENSMUSE00000292490 & ENSMUSE00000292484. This mutation is predicted to cause a frameshift with amino acid changes after residue 47 and early truncation 11 amino acids later (p.M47Sfs*13). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pebp1 Mutation: 16 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)