Nhs^em3(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nhs^em3(IMPC)Tcp
• Name: NHS actin remodeling regulator; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:5754995
• Gene: Nhs Location: ChrX:160616286-160942437 bp, - strand Genetic Position: ChrX, 74.17 cM
• Alliance: Nhs^em3(IMPC)Tcp page
• IMPC: Nhs gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and a guide with spacer sequence GTGTATACTACCGTGCACCA that targeted exon(s) ENSMUSE00000470130.6. This resulted in deletion(s) of 7 bp (location: ChrX:160658335-160658341; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nhs Mutation: 20 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)