About   Help   FAQ
Nek2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nek2em1(IMPC)Tcp
Name: NIMA (never in mitosis gene a)-related expressed kinase 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754994
Gene: Nek2  Location: Chr1:191553622-191565161 bp, + strand  Genetic Position: Chr1, 96.94 cM
Alliance: Nek2em1(IMPC)Tcp page
IMPC: Nek2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0309 was generated at the The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in a 2-bp insertion +TC in Chromosome 1 positive strand 191822642 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.465_466insTC; p.(L157Sfs*4) (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nek2 Mutation:  25 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory