Mettl3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mettl3^em1(IMPC)Tcp
• Name: methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754605
• Gene: Mettl3 Location: Chr14:52532298-52542585 bp, - strand Genetic Position: Chr14, 26.88 cM, cytoband C1
• Alliance: Mettl3^em1(IMPC)Tcp page
• IMPC: Mettl3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0368 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs (targeting AGGTAGCAGGGACCATCGCA and TATCTCCAGATCAACATCGG) targeting a critical region. This resulted in a 142 bp deletion from Chr14:52299764 to 52299905 (GRCm38) (GRCm39:chr14:52537221-52537362) in exon 3 (ENSMUSE00001224053). This mutation causes a frameshift and premature stop codon (p.I173Mfs*6). (J:165963)

Expression

In Mice Carrying this Mutation:

2 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mettl3 Mutation: 39 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)