About   Help   FAQ
Mettl3em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mettl3em1(IMPC)Tcp
Name: methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754605
Gene: Mettl3  Location: Chr14:52532298-52542585 bp, - strand  Genetic Position: Chr14, 26.88 cM, cytoband C1
Alliance: Mettl3em1(IMPC)Tcp page
IMPC: Mettl3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0368 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs (targeting AGGTAGCAGGGACCATCGCA and TATCTCCAGATCAACATCGG) targeting a critical region. This resulted in a 142 bp deletion from Chr14:52299764 to 52299905 (GRCm38) (GRCm39:chr14:52537221-52537362) in exon 3 (ENSMUSE00001224053). This mutation causes a frameshift and premature stop codon (p.I173Mfs*6). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 2 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mettl3 Mutation:  42 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory