L3mbtl4em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
L3mbtl4em1(IMPC)Tcp |
| Name: |
L3MBTL4 histone methyl-lysine binding protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:5754604 |
| Gene: |
L3mbtl4 Location: Chr17:68580792-69087081 bp, + strand Genetic Position: Chr17, 39.3 cM
|
| Alliance: |
L3mbtl4em1(IMPC)Tcp page
|
| IMPC: |
L3mbtl4 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR307 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 endonuclease and two single guide RNAs with spacer sequences CGTACATATATACTTTAGGC targeting the 5' side and CCCTATAAATGATACCACAC targeting the 3' side of exon 7 (exon ENSMUSE00000769617) resulting in deletion of Chr17 from 68456904 to 68457678.
(J:165963)
|
|
|
|
|
| Original: |
J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010; |
| All: |
3 reference(s) |
|