About   Help   FAQ
L3mbtl4em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: L3mbtl4em1(IMPC)Tcp
Name: L3MBTL4 histone methyl-lysine binding protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754604
Gene: L3mbtl4  Location: Chr17:68580792-69087081 bp, + strand  Genetic Position: Chr17, 39.3 cM
Alliance: L3mbtl4em1(IMPC)Tcp page
IMPC: L3mbtl4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR307 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 endonuclease and two single guide RNAs with spacer sequences CGTACATATATACTTTAGGC targeting the 5' side and CCCTATAAATGATACCACAC targeting the 3' side of exon 7 (exon ENSMUSE00000769617) resulting in deletion of Chr17 from 68456904 to 68457678. (J:165963)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any L3mbtl4 Mutation:  40 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory