Gm4922em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gm4922em1(IMPC)Tcp |
| Name: |
predicted gene 4922; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:5754602 |
| Gene: |
Gm4922 Location: Chr10:18655475-18662541 bp, - strand Genetic Position: Chr10, 7.92 cM
|
| Alliance: |
Gm4922em1(IMPC)Tcp page
|
| IMPC: |
Gm4922 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CAGCTCAGTGTCCTAATCAC, CTTCAGGACGGTGTACTGCC, GGGATCTTCTGGACTGCAAA, and GTGAGCTCGGTCTTGGTTTG that targeted exon(s) ENSMUSE00000403934.8 ENSMUSE00001397581.2 ENSMUSE00001401365.2. This resulted in deletion(s) of 5 bp (location: Chr10:18660931-18660935; GRCm39), 6 bp (location: Chr10:18658907-18658912; GRCm39), and 1713 bp (location: Chr10:18658929-18660641; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010; |
| All: |
4 reference(s) |
|