About   Help   FAQ
Fblim1em2Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Fblim1em2Tcp
Name: filamin binding LIM protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:5754600
Gene: Fblim1  Location: Chr4:141303373-141333351 bp, - strand  Genetic Position: Chr4, 74.64 cM, cytoband E1
Alliance: Fblim1em2Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsThis allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a p.R38Q point mutation and silent change at p.R41 to inactivate the PAM. (J:165963)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fblim1 Mutation:  82 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory