Enamem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Enamem1(IMPC)Tcp |
| Name: |
enamelin; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:5754597 |
| Gene: |
Enam Location: Chr5:88635834-88653908 bp, + strand Genetic Position: Chr5, 43.66 cM, cytoband E2
|
| Alliance: |
Enamem1(IMPC)Tcp page
|
| IMPC: |
Enam gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences GTAGGATTGTTCCCAGCGTT and TCCTGCATAATTAACCCCGG that targeted exon(s) ENSMUSE00002198356.1. This resulted in deletion(s) of 634 bp (location: Chr5:88649558-88650191; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010; |
| All: |
3 reference(s) |
|