About   Help   FAQ
Enamem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Enamem1(IMPC)Tcp
Name: enamelin; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754597
Gene: Enam  Location: Chr5:88635834-88653908 bp, + strand  Genetic Position: Chr5, 43.66 cM, cytoband E2
Alliance: Enamem1(IMPC)Tcp page
IMPC: Enam gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0357 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GTAGGATTGTTCCCAGCGTT and TCCTGCATAATTAACCCCGG targeting ENSMUSE00000355972. This resulted in a 634-bp deletion of Chr5 from 88501699 to 88502332 (GRCm38). (J:165963)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Enam Mutation:  71 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory