Eif4enif1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eif4enif1^em1(IMPC)Tcp
• Name: eukaryotic translation initiation factor 4E nuclear import factor 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754596
• Gene: Eif4enif1 Location: Chr11:3152392-3194588 bp, + strand Genetic Position: Chr11, 2.24 cM
• Alliance: Eif4enif1^em1(IMPC)Tcp page
• IMPC: Eif4enif1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele produced from project TCPR0367 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CTCTCTACCCAGCCTCGGGG and GCGCACCAGAGAAGGTCGAT. This resulted in a 5 bp deletion from Chr11:3215644 to 3215648 in ENSMUSE00001260265 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eif4enif1 Mutation: 63 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)