About   Help   FAQ
Prag1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Prag1em2(IMPC)Tcp
Name: PEAK1 related kinase activating pseudokinase 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:5754594
Gene: Prag1  Location: Chr8:36561982-36614941 bp, + strand  Genetic Position: Chr8, 22.78 cM
Alliance: Prag1em2(IMPC)Tcp page
IMPC: Prag1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0367 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GTTTACCTAGGCAGCTTCCG and ATGCAGTCCGACCATGGTAT. This resulted in a 71-bp deletion from Chr8:36102633 to 36102703 insT (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prag1 Mutation:  62 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory