Colec10^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Colec10^em2(IMPC)Tcp
• Name: collectin sub-family member 10; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5754592
• Gene: Colec10 Location: Chr15:54274170-54329754 bp, + strand Genetic Position: Chr15, 21.15 cM
• Alliance: Colec10^em2(IMPC)Tcp page
• IMPC: Colec10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0371 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of GCAAATTCAAGGAACAATAT targeting the 5' side and GCTTTTGCTCAAATGCCATA targeting the 3' side of exon ENSMUSE00000352964. This resulted in a 1,111-bp deletion from Chr15:54461596 to 54462706 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Colec10 Mutation: 27 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 2 reference(s)