About   Help   FAQ
Gpr141bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr141bem1(IMPC)Tcp
Name: G protein-coupled receptor 141B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754575
Gene: Gpr141b  Location: Chr13:19911596-19917121 bp, - strand  Genetic Position: Chr13, 7.03 cM
Alliance: Gpr141bem1(IMPC)Tcp page
IMPC: Gpr141b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with the spacer sequences CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC. This resulted in a 737-bp deletion in Chr13:19729115 to 19729852 (ENSMUSE00000732266; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 10 and early truncation 41 amino acids later (p.S10Ffs*43). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpr141b Mutation:  20 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory