About   Help   FAQ
B3galt6em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: B3galt6em2(IMPC)Tcp
Name: UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:5754562
Gene: B3galt6  Location: Chr4:156073923-156077106 bp, - strand  Genetic Position: Chr4, 87.66 cM, cytoband E2
Alliance: B3galt6em2(IMPC)Tcp page
IMPC: B3galt6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0315 at The Centre for Phenogenomics by injecting Cas9 D10A mRNA and four guide RNAs having spacer sequences AGCCGCTCGGCCCCGCGCTA, AGCGGAGGGCGTCTCGCCCT, TGTACTCCGTGTCGAAGCGT and AGGCTGCAACAATCAGTATC. This resulted in an indel comprised of a 42-bp deletion on Chr 4 from 155992472 to 155992513 with a 2-bp insertion of CC (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any B3galt6 Mutation:  2 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory