About   Help   FAQ
Nectin4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nectin4em1(IMPC)J
Name: nectin cell adhesion molecule 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5752746
Synonyms: Nectin4em1J
Gene: Nectin4  Location: Chr1:171197741-171215855 bp, + strand  Genetic Position: Chr1, 79.37 cM, cytoband H2
Alliance: Nectin4em1(IMPC)J page
IMPC: Nectin4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pvrl4-7418J-M4968 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGACTCTGAGCTTGGGCT, GGACTCTGAGCTTGGGCTGG, TCTATGCCCCGACTTAGCTA and TCTGAACCCTAGCTAAGTCG, which resulted in a 401 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 171,383,458 bp GGTCTTATGAGCTCAGGGCA and ending after ACATATTCTGAACCCTAGCT at 171,383,858 bp (GRCm38/mm10). This mutation deletes exon 4 and 280 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after amino acid residue 242 and early truncation 11 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nectin4 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory