P2ry14em2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
P2ry14em2(IMPC)H |
| Name: |
purinergic receptor P2Y, G-protein coupled, 14; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:5749948 |
| Gene: |
P2ry14 Location: Chr3:59022044-59060913 bp, - strand Genetic Position: Chr3, 28.96 cM
|
| Alliance: |
P2ry14em2(IMPC)H page
|
| IMPC: |
P2ry14 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences GTAACAAGACTGATAATACT and GTGACTGGTATCTAATACAG that targeted exon(s) ENSMUSE00000568103.5 ENSMUSE00001355758.2 ENSMUSE00001648970.1 ENSMUSE00002192418.1. This resulted in deletion(s) of 1138 bp (location: Chr3:59022420-59023557; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013; |
| All: |
2 reference(s) |
|