Spmip6em2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Spmip6em2(IMPC)H |
| Name: |
sperm microtubule inner protein 6; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:5749859 |
| Synonyms: |
Cbe1em2H |
| Gene: |
Spmip6 Location: Chr4:41505009-41517333 bp, - strand Genetic Position: Chr4, 21.7 cM, cytoband B1
|
| Alliance: |
Spmip6em2(IMPC)H page
|
| IMPC: |
Spmip6 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AAGATTACTGAGTGCGAACG, CACATTTACTCCGCCTACGC, TTACTCCGCCTACGCGGGCA, and TTACTGAGTGCGAACGAGGA that targeted exon(s) ENSMUSE00001281635.2. This resulted in deletion(s) of 330 bp (location: Chr4:41507472-41507801; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013; |
| All: |
2 reference(s) |
|