About   Help   FAQ
Ap3m2em1(IMPC)1H
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap3m2em1(IMPC)1H
Name: adaptor-related protein complex 3, mu 2 subunit; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:5749850
Gene: Ap3m2  Location: Chr8:23277370-23295638 bp, - strand  Genetic Position: Chr8, 11.42 cM
Alliance: Ap3m2em1(IMPC)1H page
IMPC: Ap3m2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR endonuclease technology mediated a mutation that results in the amino acid substitution of leucine for proline at position 157 (L157P). This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TGGAAGCTGGTCCCCCACATTGG, and a donor oligo, which resulted in a Indel. (J:90559)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ap3m2 Mutation:  26 strains or lines available
References
Original:  J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory