Ap3m2^em1(IMPC)1H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap3m2^em1(IMPC)1H
• Name: adaptor-related protein complex 3, mu 2 subunit; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:5749850
• Gene: Ap3m2 Location: Chr8:23277370-23295638 bp, - strand Genetic Position: Chr8, 11.42 cM
• Alliance: Ap3m2^em1(IMPC)1H page
• IMPC: Ap3m2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR endonuclease technology mediated a mutation that results in the amino acid substitution of leucine for proline at position 157 (L157P). This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TGGAAGCTGGTCCCCCACATTGG, and a donor oligo, which resulted in a Indel. (J:90559)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ap3m2 Mutation: 26 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 2 reference(s)