About   Help   FAQ
Hpse2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hpse2em1(IMPC)J
Name: heparanase 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749801
Synonyms: Hpse2em1J
Gene: Hpse2  Location: Chr19:42774978-43376794 bp, - strand  Genetic Position: Chr19, 36.57 cM
Alliance: Hpse2em1(IMPC)J page
IMPC: Hpse2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Hpse2-7398J-F2290 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTCCAACACTCAAAAT, GTCCCGATTTTGAGTGTTGG, GTGCTCTCTAGCCTTCTCCC, and TAGATAATAAATCTCCCACC, which resulted in a 285 bp deletion spanning exon 2 beginning at Chromosome 19 negative strand position 43,385,002 bp, CCCACCAGGTCTCCTGCAGG and ending after AGAAATTTGGTCCCGATTTT at 43,384,718 bp (GRCm38/mm10). This mutation deletes exon 2 and 127 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after 96 amino acids and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Hpse2 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory