Loxl1^em2J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Loxl1^em2J
• Name: lysyl oxidase-like 1; endonuclease-mediated mutation 2, Jackson
• MGI ID: MGI:5706768
• Gene: Loxl1 Location: Chr9:58195021-58220469 bp, - strand Genetic Position: Chr9, 31.65 cM
• Alliance: Loxl1^em2J page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: This loxP flanked allele from project Loxl1-6513J-101P2M(2R)was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, GAATGGCATGCCACAAGTAA and TCAGATACTTTGCCAGACTC, along with a plasmid containing 2618 bp of Loxl1 sequence comprised of 1 kb 5-prime and 3-prime homology arms with two 60 bp-cassettes flanking exon 2 that contain a loxP site, HindIII cut site, and an additional unique 20 bp sequence as a sequencing primer. This allele shows a complete integration of the Loxl1 2618 bp sequence by homologous recombination beginning in Chromosome 9 negative strand position 58,298,994 bp CATGACTCAAGCACCCCATCTTTAC, and ending after GGACTATCTTAAGTGCCCAGC at 58,296,497 bp (GRCm38), resulting in a loxP flanked exon 2. It is predicted that mating this strain with cre will generate a deletion of exon 2 causing a change of amino acid sequence after amino acid 400 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Loxl1 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)