About   Help   FAQ
Rxfp3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rxfp3em1(IMPC)J
Name: relaxin family peptide receptor 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5697049
Synonyms: Rxfp3em1J
Gene: Rxfp3  Location: Chr15:11033803-11038054 bp, - strand  Genetic Position: Chr15, 5.42 cM
Alliance: Rxfp3em1(IMPC)J page
IMPC: Rxfp3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rxfp3-6943J-F9508 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGTGGCTTCTGCAACCCCCG, with a non-contributing plasmid, which resulted in a 20 bp deletion (TGCAGGTGGCTTCTGCAACC) in exon 1 beginning at Chromosome 15 positive strand position 11,037,264 bp (GRCm38/mm10). The 20 bp deletion alters the coding sequence such that the first 11 amino acids are changed followed by a stop codon, and is therefore predicted to be a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rxfp3 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory