Zfp329^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp329^em1(IMPC)J
• Name: zinc finger protein 329; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5695254
• Synonyms: Zfp329^em1J
• Gene: Zfp329 Location: Chr7:12538904-12552785 bp, - strand Genetic Position: Chr7, 7.64 cM, cytoband A2
• Alliance: Zfp329^em1(IMPC)J page
• IMPC: Zfp329 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp329-7039J-F1199 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGTTGAGTGGCTTCCATGGA and CAAGAGATTTTATAAAGGTA, which resulted in a 13bp deletion beginning in exon 2 ATGGAAGCCACTC at Chromosome 7 negative strand position 12,811,259 bp ATGGAAGCCACTC (GRCm38) and ending after position 12,811,246 bp in exon 2. This mutation is predicted to cause amino acid sequence changes after 112 amino acid residues and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp329 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)