Zfp174em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp174em1(IMPC)J |
Name: |
zinc finger protein 174; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5689892 |
Synonyms: |
Zfp174em1J |
Gene: |
Zfp174 Location: Chr16:3665132-3676744 bp, + strand Genetic Position: Chr16, 2.26 cM
|
Alliance: |
Zfp174em1(IMPC)J page
|
IMPC: |
Zfp174 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Zfp174-7014J-2R1L(MP1) was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATAGAGTGACCCCCTTACCC, TCCCAGCAGAGACATTCAGG, TGGGAGGCTGTGATGGAAAG, which resulted in a 194 bp deletion beginning in intron 2 at Chromosome 16 positive strand position 3,849,266 bp, TAAGGGGGTCACTCTATAGC, and ending after CTCCCAGCAGAGACATTC at 3,849,459 bp(GRCm38/mm10) in exon 2. This mutation deletes 85 bp of intronic sequence and the splice acceptor as well as 109 bp of exon 2 resulting in a complete deletion of exon 2. This mutation is predicted to result in a change of amino acid sequence after amino acid 134 and early truncation 4 amino acids later. There is also an additional 15 bp insertion, GAATGGAGATAAGAG, at position 3,849,603 bp in intron 3 that will not affect the predicted mutation.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|