Zfp174^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp174^em1(IMPC)J
• Name: zinc finger protein 174; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5689892
• Synonyms: Zfp174^em1J
• Gene: Zfp174 Location: Chr16:3665132-3676744 bp, + strand Genetic Position: Chr16, 2.26 cM
• Alliance: Zfp174^em1(IMPC)J page
• IMPC: Zfp174 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp174-7014J-2R1L(MP1) was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATAGAGTGACCCCCTTACCC, TCCCAGCAGAGACATTCAGG, TGGGAGGCTGTGATGGAAAG, which resulted in a 194 bp deletion beginning in intron 2 at Chromosome 16 positive strand position 3,849,266 bp, TAAGGGGGTCACTCTATAGC, and ending after CTCCCAGCAGAGACATTC at 3,849,459 bp(GRCm38/mm10) in exon 2. This mutation deletes 85 bp of intronic sequence and the splice acceptor as well as 109 bp of exon 2 resulting in a complete deletion of exon 2. This mutation is predicted to result in a change of amino acid sequence after amino acid 134 and early truncation 4 amino acids later. There is also an additional 15 bp insertion, GAATGGAGATAAGAG, at position 3,849,603 bp in intron 3 that will not affect the predicted mutation. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp174 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)