About   Help   FAQ
Arhgap36em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arhgap36em1(IMPC)J
Name: Rho GTPase activating protein 36; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688777
Synonyms: Arhgap36em1J
Gene: Arhgap36  Location: ChrX:48552822-48589121 bp, + strand  Genetic Position: ChrX, 25.95 cM
Alliance: Arhgap36em1(IMPC)J page
IMPC: Arhgap36 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arhgap36-7011J-LMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATCCAGCCTATGATGGACA, TCTCACGAAAAAACTCCTTG, and TGCCCTCCATTGTTGGAGCA, which resulted in a 163 bp deletion beginning in intron 7 at Chromosome X positive strand position 49,496,368 bp, CTTGAAGAACTGTTCAAGAT and ending after CTGAGCTCCTCAAGGAGTTTTTT at 49,496,530 bp (GRCm38/mm10) in exon 7. This 163 bp deletion removes the splice acceptor and 90 bp of exon 7 effectively deleting the entire exon and is predicted to result in early truncation 257 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arhgap36 Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory