Cdrt4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdrt4^em1(IMPC)J
• Name: CMT1A duplicated region transcript 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688776
• Synonyms: Cdrt4^em1J
• Gene: Cdrt4 Location: Chr11:62842019-62883921 bp, + strand Genetic Position: Chr11, 38.84 cM, cytoband B2
• Alliance: Cdrt4^em1(IMPC)J page
• IMPC: Cdrt4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cdrt4-7035J-M1117 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GCATCTGTCACGGTGAGTAG, CTGGCTACTGAACCACCTCA, ACAAAGAGGGAAGGCTAGTC, and AGGGCATGACCCATAGAGTT, which resulted in a 396 bp deletion beginning before the 5 UTR at Chromosome 11 positive strand position 62,951,152 bp, GTCACAATGCCTCTACTCACCG, and ending after CAAGATCACAGTTCACATCACCT at 62,951,547 bp (GRCm38/mm10) in intron 2. This mutation deletes exon 1 and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdrt4 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)