Zfp422^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp422^em1(IMPC)J
• Name: zinc finger protein 422; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688574
• Synonyms: Zfp422^em1J
• Gene: Zfp422 Location: Chr6:116600977-116605960 bp, - strand Genetic Position: Chr6, 53.83 cM
• Alliance: Zfp422^em1(IMPC)J page
• IMPC: Zfp422 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp422-7040J-M1223 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCACACTCATCACAGCAGTA and GTGGCCATTCGCTTCGACTC, which resulted in a 301 bp deletion beginning in exon 2 at Chromosome 6 negative strand position 116,626,917bp, CTCGGGCTTGAGTCGACGGA, and ending after ACCGGCGAGAAGCCCTACTGC at 116,626,617 bp (GRCm38/mm10) in exon 2. This mutation results in the deletion of 301 bp in exon 2 and results in an amino acid sequence change after residue 40 and early truncation 41 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp422 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)