Pbsn^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pbsn^em1(IMPC)J
• Name: probasin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662440
• Synonyms: Pbsn^em1J
• Gene: Pbsn Location: ChrX:76881504-76897106 bp, - strand Genetic Position: ChrX, 38.32 cM, cytoband A7.1
• Alliance: Pbsn^em1(IMPC)J page
• IMPC: Pbsn gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pbsn-6978J-F3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TTAAGGTCGTGCATTCATTC,ACATTGGAATGTAGATATCA,TCGTATTGTATATTACTCCA, and TTTATGTGGAATCAGGACCC, which resulted in a 212 bp deletion in intron 3 beginning at Chromosome X negative strand position 77,845,123 bp, CCCTGGAGTAATATACAATACG, and ending after TGATATCTACATTCCAATGTAA at 77,844,912 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause early truncation after 72 amino acids. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pbsn Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)