About   Help   FAQ
Abca16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Abca16em1(IMPC)J
Name: ATP-binding cassette, sub-family A member 16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5659623
Synonyms: Abca16em1J
Gene: Abca16  Location: Chr7:120008870-120144036 bp, + strand  Genetic Position: Chr7, 64.86 cM, cytoband F3
Alliance: Abca16em1(IMPC)J page
IMPC: Abca16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Abca16-6894J-M2454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GTTTCATCTCTAAAGTCACT, TAACTTGTCTGGCCACCAGA and CAAGCTACTACTGTTATGCC, which resulted in a 112 bp deletion beginning in intron 2 at Chromosome 7 positive strand position 120,431,039 bp, at ACTTGGTTTTCTACTGGGATGTA, and ending after TTGGTGCACAGAGGACCATCT at position 120,431,150 bp in exon 2 (GRCm38). This mutation deletes 43 bp in exon 2 as well as the splice acceptor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 20 and early truncation 43 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abca16 Mutation:  92 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory