Ccdc78^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc78^em1(IMPC)J
• Name: coiled-coil domain containing 78; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5649017
• Synonyms: Ccdc78^em1J
• Gene: Ccdc78 Location: Chr17:26005554-26009487 bp, + strand Genetic Position: Chr17, 12.89 cM
• Alliance: Ccdc78^em1(IMPC)J page
• IMPC: Ccdc78 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccdc78-6895J-M2468 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, GATCCTTCTTTAGGGGATGA, CAGGACAACTGGTCAGCAAC and CTTGGGTACTCCCAGGTGCT, which resulted in a 205 bp deletion beginning in intron 6 at Chromosome 17 positive strand position 25,787,901 bp, beginning at GGATGACGGATGACCTCACCC, and ending after AAACAGAGCAATCGCCTCTTG at position 25,788,105 bp in intron 7 (GRCm38). This mutation deletes exon 6 and is predicted to cause amino acid sequence changes after residue 167 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc78 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)